<?xml version="1.0" encoding="utf-8" ?>
<article xml:lang="en" article-type="research-article" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
    <front>
        <journal-meta>
            <journal-id journal-id-type="publisher-id">PSJFS</journal-id>
            <journal-title-group>
                <journal-title>Potravinarstvo Slovak Journal of Food Sciences</journal-title>
                <abbrev-journal-title abbrev-type="pubmed">Potr. S. J. F. Sci.</abbrev-journal-title>
            </journal-title-group>
            <issn pub-type="ppub">1338-0230</issn>
            <issn pub-type="epub">1337-0960</issn>
            <publisher>
                <publisher-name>Association HACCP Consulting</publisher-name>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="publisher-id">PSJFS-15-1-627</article-id>
            <article-id pub-id-type="doi">10.5219/1664</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>ARTICLE</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>GENETIC IDENTIFICATION OF THE CAUSATIVE AGENT OF BRUCELLOSIS</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Jakipov</surname>
                        <given-names>Yerkebulan</given-names>
                    </name>
                    <xref ref-type="aff" rid="aff1" />
                    <xref ref-type="corresp" rid="cor1">&#x002A;</xref>
                </contrib>
                <contrib contrib-type="author">
                    <name>
                        <surname>Mustafin</surname>
                        <given-names>Muafik</given-names>
                    </name>
                    <xref ref-type="aff" rid="aff2" />
                </contrib>
                <contrib contrib-type="author">
                    <name>
                        <surname>Valdovska</surname>
                        <given-names>Anda</given-names>
                    </name>
                    <xref ref-type="aff" rid="aff3" />
                </contrib>
                <contrib contrib-type="author">
                    <name>
                        <surname>Baiseitov</surname>
                        <given-names>Sayat</given-names>
                    </name>
                    <xref ref-type="aff" rid="aff4" />
                </contrib>
                <contrib contrib-type="author">
                    <name>
                        <surname>Aitkulova</surname>
                        <given-names>Ayauly</given-names>
                    </name>
                    <xref ref-type="aff" rid="aff5" />
                </contrib>
                <aff id="aff1">
                    <institution>Yerkebulan Jakipov, Akhmet Baitursynov Kostanay State University, Department of Veterinary Medicine, Baytursynov Str., 47A, 110000, Kostanay, Republic of Kazakhstan, Tel.: +7 (7142) 558463, E-mail: jakipov6056@nuos.pro</institution>
                </aff>
                <aff id="aff2">
                    <institution>Muafik Mustafin, Akhmet Baitursynov Kostanay State University, Department of Veterinary Medicine, Baytursynov Str., 47A, 110000, Kostanay, Republic of Kazakhstan, Tel.: +7 (7142) 558488, E-mail: mmustafin@tanu.pro</institution>
                </aff>
                <aff id="aff3">
                    <institution>Anda Valdovska, Latvia University of Life Sciences and Technologies, Faculty of Veterinary Medicine, Liela Str., 2, LV-3001, Jelgava, Latvia, Tel.: +371 630 24662, E-mail: valdovska65@politechnika.pro</institution>
                </aff>
                <aff id="aff4">
                    <institution>Sayat Baiseitov, Omsk State Agrarian University named after P.A. Stolypin, Department of Veterinary Microbiology, Infectious and Invasive Diseases, Institutskaya Sq., 1, 644008, Omsk, Russian Federation, Tel.: +7 (3812) 25-05-70, E-mail: s.baiseitov@tanu.pro</institution>
                </aff>
                <aff id="aff5">
                    <institution>Ayauly Aitkulova, Kazakh National Agrarian University, Department of Biological Safety, Abai Ave., 8, 050010, Almaty, Republic of Kazakhstan, Tel.: +7 (727) 261-5857, E-mail: aaitkulova@nuos.pro</institution>
                </aff>
            </contrib-group>
            <author-notes>
                <corresp id="cor1">
                    <label>&#x002A;</label>
                    <email xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="jakipov6056@nuos.pro">jakipov6056@nuos.pro</email>
                </corresp>
            </author-notes>
            <pub-date pub-type="epub">
                <day>28</day>
                <month>7</month>
                <year>2021</year>
            </pub-date>
            <pub-date pub-type="ppub">
                <month>7</month>
                <year>2021</year>
            </pub-date>
            <volume>15</volume>
            <issue>1</issue>
            <fpage>627</fpage>
            <lpage>631</lpage>
            <history>
                <date date-type="received">
                    <day>23</day>
                    <month>4</month>
                    <year>2021</year>
                </date>
                <date date-type="accepted">
                    <day>6</day>
                    <month>6</month>
                    <year>2021</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>&#x00A9; Association HACCP Consulting. All rights reserved.</copyright-statement>
                <copyright-year>2021</copyright-year>
                <license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by-nc/3.0/">
                    <license-p>This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (<uri xlink:href="http://creativecommons.org/licenses/by-nc/3.0/">http://creativecommons.org/licenses/by-nc/3.0</uri>) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <abstract>
                <p>The development of animal husbandry suffers various kinds of losses due to the spread of infectious diseases among animals, in particular Brucellosis. A challenge faced by <italic>Brucella</italic> researchers has been the accurate identification of new isolates within the genus while preserving sufficient, and not excessive, biosafety and biosecurity requirements. The availability of discriminatory molecular typing tools to inform and assist conventional epidemiological approaches would be invaluable in controlling these infections, but efforts have been hampered by the genetic homogeneity of the genus. In this work, for better identification of infection, for control and monitor the source of outbreaks in prosperous areas was carried out identification of <italic>Brucella</italic> spp. strains which circulating in the Kostanay region. For this was used using multilocus analysis of a variable number of tandem repeats sequenced by 16 s – PNK on a genetic analyzer (sequencer). According to the results of a study of cattle, cultures of microorganisms were infected: No. 4, 5, 7, 8. Comparison of the obtained results with similar results of domestic and foreign works by A. Shevtsov, G. Borrello, P. Le Fleche, G. Garofolo suggest that the genotyping of local strains has an importance in the molecular epizootology of the Republic of Kazakhstan.</p>
                <p>
                    <bold>Keywords:</bold> amplification; sequencing; <italic>Brucella</italic> abortus; <italic>Brucella</italic> melitensis; strain</p>
            </abstract>
        </article-meta>
    </front>
    <body>
        <sec sec-type="intro">
            <title>INTRODUCTION</title>
            <p>Brucellosis is a zoonotic disease of major public health, animal welfare, and economic significance worldwide. In humans, infection with <italic>Brucella</italic> can lead to a chronic debilitating infection; in domesticated animals, the main symptom is a reproductive failure. Among the 12 species currently proposed in this genus, <italic>Brucella melitensis</italic>, <italic>Brucella abortus</italic>, and <italic>Brucella suis</italic> are highly dangerous for humans and cause diseasewith severe complications and chronic processes (<xref ref-type="bibr" rid="b18">Meyer, 1990;</xref> <xref ref-type="bibr" rid="b14">Godfroid et al., 2011</xref>). Rare cases of infection of people with other <italic>Brucella</italic> species are also recorded (<xref ref-type="bibr" rid="b9">Ficht, 2010</xref>). Despite its low mortality rates, brucellosis is a very important public health problem in Kazakhstan. Brucellosis causes great economic damage to livestock. The disease is accompanied by mass abortions and barrenness of animals suffering from brucellosis, joint damage, inflammation of mucous bags (in horses at the withers and the nape of the neck), the sex glands, the appearance of abscesses (more often in pigs), a decrease in the viability of offspring, a decrease in animal productivity. At the same time, elimination of brucellosis requires great effort and cost (<xref ref-type="bibr" rid="b7">Demirev, 2013;</xref> <xref ref-type="bibr" rid="b24">Whatmore et al., 2006;</xref> <xref ref-type="bibr" rid="b23">Whatmore, 2009</xref>). The development of discriminatory molecular tools for the identification and typing of <italic>Brucella</italic> has been problematic, reflecting the lack of genetic polymorphism in <italic>Brucella</italic>.</p>
            <p>To address the issue of epizootology and understanding the pathogenesis of the disease, an accurate and timely diagnosis is necessary. The success of the fight against brucellosis depends on the rate of detection of all infected animals, on the effectiveness of diagnostic studies. The traditional system of identification and systematization of isolated field strains of <italic>Brucella</italic> is imperfect. None of the existing molecular tools provide adequate resolution to confidently permit epidemiological traceback in the case of accidental import or deliberate release. The phenotypic methods used allow differentiation of the causative agent of brucellosis to the species-specific level, but they are characterized by laboriousness, duration, and non-specificity of the analysis (<xref ref-type="bibr" rid="b23">Whatmore, 2009;</xref> <xref ref-type="bibr" rid="b2">Alton et al., 1988;</xref> <xref ref-type="bibr" rid="b17">Le Fl&#xE8;che et al., 2006</xref>). These methods do not meet modern typing requirements. The solution to this problem is seen in the use of modern methods of molecular genetic typing of <italic>Brucella</italic> isolates.</p>
            <p>Using molecular methods of analysis, genomic polymorphism is simply detected &#x2013; quantitative changes in mini- and microsatellite DNA sequences (decrease or increase in the number of repeats), creating a series of unique alleles for each variable locus. These types of polymorphic loci are convenient markers. The phenomenon of polymorphism underlies the common method of identifying mutant DNA fragments &#x2013; analysis of microsatellite markers (<xref ref-type="bibr" rid="b3">Ayala and Kiger, 1980;</xref> <xref ref-type="bibr" rid="b13">Gershkovich, 1968;</xref> <xref ref-type="bibr" rid="b1">Al Dahouk et al., 2007</xref>, <xref ref-type="bibr" rid="b16">Kattar et al., 2008</xref>). In this regard, the use of information about the causative agent of brucellosis obtained in the analysis of multilocus provides high-quality, effective elimination and prevention of the infectious process.</p>
            <sec>
                <title>Scientific Hypothesis</title>
                <p>Using multilocus analysis with a variable number of tandem to create a molecular genetic cluster in the 16S rRNA epizootic. Recursive multistep analysis of a tandem of a molecular genetic cluster in epizootology using 16S rRNA in the Kostanay region strain of genotyping. In addition, the data obtained can be used for epidemiological surveillance and rapid detection of foci of brucellosis in epidemic zones. Currently, the research of the genetic modification of <italic>Brucella</italic> through 16s rRNA is necessary for a better understanding of the spread and monitoring of the occurrence of this infection in these areas.</p>
            </sec>
        </sec>
        <sec sec-type="materials|methods">
            <title>MATERIAL AND METHODOLOGY</title>
            <sec>
                <title>Samples</title>
                <p>An object of study &#x2013; cultures of microorganisms: No. 4, 5, 7, 8. The subject of the study is the polymorphism of a fragment of ribosomal RNA (16S rRNA). The study material &#x2013; samples of genomic DNA isolated from the obtained cultures of microorganisms.</p>
            </sec>
            <sec>
                <title>Instruments</title>
                <p>Capillary genetic analyzer 8-16s rrna 3500 genetic Analyzer (&#x22;Applied Biosystems&#x22;, USA) for genotyping and defining <italic>Brucella</italic> isolators is a worthy tool for identifying genotypes.</p>
            </sec>
            <sec>
                <title>Laboratory Methods</title>
                <p>On the initial stages of the work, the following processes took place:</p>
                <list list-type="simple">
                    <list-item>
                        <p>1. Isolation of DNA from microorganism cultures. For DNA extraction, the commercial CTAB Sample Kit was used (DNA-Technology, Russia). The work with the kit was carried out following the manufacturer&#x27;s instructions.</p>
                    </list-item>
                    <list-item>
                        <p>2. Determination of DNA nucleotide sequence by the method of F. Sanger (enzymatic method)</p>
                    </list-item>
                    <list-item>
                        <p>3. Sequencing steps. Sequencing of amplification fragments was performed using the ABI PRISM Big Dye Terminator v.3.1 kit (Applied Biosystems, USA), according to the manufacturer&#x27;s instructions using the Applied Biosystems 3500 Genetic Analyzer 8 capillary genetic analyzer (Applied Biosystems, USA). After conducting electrophoretic analysis of amplification 2 using 2% agarose, we placed micro schemes with amplification products as a tripod. Each row of gel tracks must have a DNA molecular weight marker (<xref ref-type="bibr" rid="b8">Ferreira et al., 2012</xref>). Next on paraffin paper with a pipette dosing, we add 10 &#x3BC;L of amplification, 2 &#x3BC;L of 6X DNA Loading Dye, pipetting. 10 &#x3BC;L is poured into the well of the agarose gel. Electrophoresis results were registered using a QUANTUM Model 1100 SUPER Documentation System Gel, which has ultra-high sensitivity, including for fluorescence, is controlled via PC. One band is visible on the resulting image, which indicates the purity of the obtained cultures, the presence of two or more bands in the results indicates that the cultures are contaminated by other microorganisms (<xref ref-type="bibr" rid="b6">Corbel, 1997;</xref> <xref ref-type="bibr" rid="b11">Gandara et al., 2001</xref>). In this case, it is impossible to conduct sequencing of this culture (<xref ref-type="bibr" rid="b24">Whatmore et al., 2006</xref>, <xref ref-type="bibr" rid="b15">Gwida et al., 2012</xref>).</p>
                    </list-item>
                    <list-item>
                        <p>4. Clearing the amplification from residual reagents with CleanSweep reagent, mix composition. Incubated at 37 &#xB0;C &#x2013; 15 min, 80 &#xB0;C &#x2013; 15 min and left for storage.</p>
                    </list-item>
                </list>
            </sec>
            <sec>
                <title>Sample preparation</title>
                <p>Cultures were obtained in the Kostanay regional branch of RSE on REM &#x22;Republican veterinary laboratory&#x22;. Microorganisms had been seeded on a specific nutrient medium for <italic>Brucella</italic> &#x2013; erythritol agar had been grown for 20 &#x2013; 30 days at 37 &#x2013; 38 &#x2103;. For microscopic examination, staining was performed according to Shuliak-Shin.</p>
            </sec>
            <sec>
                <title>Statistical Analysis</title>
                <p>Sequence data were obtained by overlaying the sequenced sequences from the forward and reverse primers using the SeqMan program (Lasergene 6). Alignment was performed using the on-line BLAST program hosted on the NCBI website &#x2013; National Center for Biotechnological Information, USA.</p>
            </sec>
        </sec>
        <sec sec-type="results|discussion">
            <title>RESULTS AND DISCUSSION</title>
            <p>Since there were essentially no molecular tools that could provide useful discrimination beyond the level of biovar, the first aim of this study was to characterize highly discriminatory loci that would facilitate the development of tools to permit epidemiological traceback of <italic>Brucella</italic> to the source of infection The initial stages of the work focused on: 1. Isolation of DNA from microorganism cultures; 2. Determination of DNA nucleotide sequence; 3. Sequencing steps; 4. Cleared the amplification from residual reagents with CleanSweep reagent, mix composition (Table <xref ref-type="table" rid="T1">1</xref>).</p>
            <table-wrap id="T1" position="float">
                <label>Table 1</label>
                <caption>
                    <p>The composition of the mixture for the purification of amplification products.</p>
                </caption>
                <table frame="hsides" rules="none" width="100%">
                    <thead>
                        <tr>
                            <th align="left">Mix component</th>
                            <th align="left">Amount per reaction</th>
                        </tr>
                        <tr>
                            <th colspan="5">
                                <hr/>
                            </th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td>CleanSweep</td>
                            <td>2 &#xB5;L</td>
                        </tr>
                        <tr>
                            <td>Amplification</td>
                            <td>5&#xB5;L</td>
                        </tr>
                    </tbody>
                </table>
            </table-wrap>
            <p>Then a sequencing reaction was performed. Each PCR product was pipetted into the 2 wells of a strip of 1 &#x3BC;L (the primers were excavated separately in the wells, to the first was added straight, to the second &#x2013; the reverse) + the reaction mixture of the following composition (Table <xref ref-type="table" rid="T2">2</xref>).</p>
            <table-wrap id="T2" position="float">
                <label>Table 2</label>
                <caption>
                    <p>The reaction mixture for sequencing.</p>
                </caption>
                <table frame="hsides" rules="none" width="100%">
                    <thead>
                        <tr>
                            <th>Component of the reaction mixture</th>
                            <th>Amount per reaction</th>
                        </tr>
                        <tr>
                            <th colspan="5">
                                <hr/>
                            </th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td>Primer 16S-F (ITS-F), either primer 16S-R (ITS-R)</td>
                            <td>1 &#xB5;L</td>
                        </tr>
                        <tr>
                            <td>Purified amplification</td>
                            <td>1,5 &#xB5;L</td>
                        </tr>
                        <tr>
                            <td>Big Dye Terminator 3.1 Ready Reaction Mix</td>
                            <td>4 &#xB5;L</td>
                        </tr>
                        <tr>
                            <td>Deionized water</td>
                            <td>4 &#xB5;L</td>
                        </tr>
                    </tbody>
                </table>
            </table-wrap>
            <p>Put on the amplification according to the following program (Table <xref ref-type="table" rid="T3">3</xref>). The rate of increase or decrease in temperature &#x2013; 1 &#xB0;C/sec.</p>
            <table-wrap id="T3" position="float">
                <label>Table 3</label>
                <caption>
                    <p>Amplification program</p>
                </caption>
                <table frame="hsides" rules="none" width="100%">
                    <thead>
                        <tr>
                            <th align="left">Temperature</th>
                            <th align="left">Time</th>
                            <th align="left">Number of cycles</th>
                        </tr>
                        <tr>
                            <th colspan="5">
                                <hr/>
                            </th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td>96&#xB0;C</td>
                            <td>1 min</td>
                            <td/>
                        </tr>
                        <tr>
                            <td>96&#xB0;C</td>
                            <td>10 sec</td>
                            <td rowspan="3">25 cycles</td>
                        </tr>
                        <tr>
                            <td>50&#xB0;C</td>
                            <td>5 sec</td>
                        </tr>
                        <tr>
                            <td>60&#xB0;C</td>
                            <td>1,5 min</td>
                        </tr>
                        <tr>
                            <td>4&#xB0;C</td>
                            <td colspan="2">storage</td>
                        </tr>
                    </tbody>
                </table>
            </table-wrap>
            <p>Purification (precipitation) before sequencing (performed in a plate with cooling) was performed.</p>
            <p>45 &#x3BC;L Sam Solution and 10 &#x3BC;L Xterminator Solution had been added to the amplification obtained after the sequential reaction, shaking the reagent strongly, as it quickly precipitated. The resulting mixture was vortexed at 1800 rpm for 20 minutes using Digital Vortex-Genie 2. After that, the plate was centrifuged at 1000g for 2 minutes. 15 &#x3BC;L of the supernatant was collected and the plate was loaded into the sequencer. As a result of sequencing the cultures of microorganisms, the following results were obtained (Table <xref ref-type="table" rid="T4">4</xref>, Figure <xref ref-type="fig" rid="F1">1</xref>).</p>
            <table-wrap id="T4" position="float">
                <label>Table 4</label>
                <caption>
                    <p>Results of identification by the method of analysis of the nucleotide sequence of the gene 16S rRNA.</p>
                </caption>
                <table frame="hsides" rules="none" width="100%">
                    <thead>
                        <tr>
                            <th rowspan="3">The name of the strain</th>
                            <th rowspan="3">The sequence of the fragment 16S r RNA</th>
                            <th colspan="2">Identification of nucleotide sequences in the international database (http://www.ncbi.nlm.nih.gov/) BLAST algorithm</th>
                        </tr>
                        <tr>
                            <th colspan="2">
                                <hr/>
                            </th>
                        </tr>
                        <tr>
                            <th>The name of the strain</th>
                            <th>matches</th>
                        </tr>
                        <tr>
                            <th colspan="5">
                                <hr/>
                            </th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr align="center">
                            <td rowspan="3">1/8</td>
                            <td rowspan="3">GTATCAAAGGCAGTTCCGGGGTTGAGCCCCGGGATTTCACCCCTGACTTAAAAGTCCGCCTACGTGCGCTTTACGCCCAGTAAATCCGAACAACGCTAGCCCCCTTCGTATTACCGCGGCTGCTGGCACGAAGTTAGCCGGGGCTTCTTCTCCGGTTACCGTCATTATCTTCACCGGTGAAAGAGCTTTACAACCCTAGGGCCTTCATCACTCACGCGGCATGGCTGGATCAGGCTTGCGCCCATTGTCCAATATTCCCCACTGCTGCCTCCCGTAA</td>
                            <td> <italic>Brucella abortus</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td> <italic>Brucella melitensis</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td> <italic>Brucella canis</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td rowspan="3">2/8</td>
                            <td rowspan="3">TCCGGGGTTGAGCCCCGGGATTTCACCCCTGACTTAAAAGTCCGCCTACGTGCGCTTTACGCCCAGTAAATCCGAACAACGCTAGCCCCCTTCGTATTACCGCGGCTGCTGGCACGAAGTTAGCCGGGGCTTCTTCTCCGGTTACCGTCATTATCTTCACCGGTGAAAGAGCTTTACAACCCTAGGGCCTTCATCACTCACGCGGCATGGCTGGATCAGGCTTGCGCCCATTGTCCAATATTCCCCACTGCTGCCTCCCGTA</td>
                            <td> <italic>Brucella abortus</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td> <italic>Brucella melitensis</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td> <italic>Brucella canis</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td rowspan="3">4/8</td>
                            <td rowspan="3">AGTTCCGGGGTTGAGCCCCGGGATTTCACCCCTGACTTAAAAGTCCGCCTACGTGCGCTTTACGCCCAGTAAATCCGAACAACGCTAGCCCCCTTCGTATTACCGCGGCTGCTGGCACGAAGTTAGCCGGGGCTTCTTCTCCGGTTACCGTCATTATCTTCACCGGTGAAAGAGCTTTACAACCCTAGGGCCTTCATCACTCACGCGGCATGGCTGGATCAGGCTTGCGCCCATTGTCCAATATTCCCCACTGCTGCCTC</td>
                            <td> <italic>Brucella abortus</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td> <italic>Brucella melitensis</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td> <italic>Brucella canis</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td rowspan="3">5/5&#x43C;</td>
                            <td rowspan="3">ACCTCTACACTCGGAATTCCACTCACCTCTACCATACTCAAGACTTCCAGTATCAAAGGCAGTTCCGGGGTTGAGCCCCGGGATTTCACCCCTGACTTAAAAGTCCGCCTACGTGCGCTTTACGCCCAGTAAATCCGAACAACGCTAGCCCCCTTCGTATTACCGCGGCTGCTGGCACGAAGTTAGCCGGGGCTTCTTCTCCGGTTACCGTCATTATCTTCACCGGTGAAAGAGCTTTACAACCCTAGGGCCTTCATCACTCACGCGGCATGGCTGGATCAGGCTTGCGCCCATTGTCCAATATTCCCCACTGCTGCCTCCCGTAA</td>
                            <td> <italic>Brucella abortus</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td> <italic>Brucella melitensis</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td> <italic>Brucella canis</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td rowspan="3">6/5</td>
                            <td rowspan="3">GGGGCTAGCGTTGTTCGGATTTACTGGGCGTAAAGCGCACGTAGGCGGACTTTTAAGTCAGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTTTGATACTGGAAGTCTTGAGTATGGTAGAGGTGAGTGGAATTCCGAGTGTAGAGGTGAAATTCGTAGATATTCGGAGGAACACCAGTGGCGAAGGCGGCTCACTGGACCATTACTGACGCTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTA</td>
                            <td> <italic>Brucella abortus</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td> <italic>Brucella melitensis</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td> <italic>Brucella canis</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td rowspan="3">7/5</td>
                            <td rowspan="3">AGGGGGCTAGCGTTGTTCGGATTTACTGGGCGTAAAGCGCACGTAGGCGGACTTTTAAGTCAGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTTTGATACTGGAAGTCTTGAGTATGGTAGAGGTGAGTGGAATTCCGAGTGTAGAGGTGAAATTCGTAGATATTCGGAGGAACACCAGTGGCGAAGGCGGCTCACTGGACCATTACTGACGCTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGA</td>
                            <td> <italic>Brucella abortus</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td> <italic>Brucella melitensis</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td> <italic>Brucella canis</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td rowspan="3">8/5</td>
                            <td rowspan="3">CTTCCAGTATCAAAGGCAGTTCCGGGGTTGAGCCCCGGGATTTCACCCCTGACTTAAAAGTCCGCCTACGTGCGCTTTACGCCCAGTAAATCCGAACAACGCTAGCCCCCTTCGTATTACCGCGGCTGCTGGCACGAAGTTAGCCGGGGCTTCTTCTCCGGTTACCGTCATTATCTTCACCGGTGAAAGAGCTTTACAACCCTAGGGCCTTCATCACTCACGCGGCATGGCTGGATCAGGCTTGCGCCCATTGTCCAATATTCCCCACTGCTGCCTCCCGTAA</td>
                            <td> <italic>Brucella abortus</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td> <italic>Brucella melitensis</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td> <italic>Brucella canis</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td rowspan="3">9/7</td>
                            <td rowspan="3">ACCTCTACACTCGGAATTCCACTCACCTCTACCATACTCAAGACTTCCAGTATCAAAGGCAGTTCCGGGGTTGAGCCCCGGGATTTCACCCCTGACTTAAAAGTCCGCCTACGTGCGCTTTACGCCCAGTAAATCCGAACAACGCTAGCCCCCTTCGTATTACCGCGGCTGCTGGCACGAAGTTAGCCGGGGCTTCTTCTCCGGTTACCGTCATTATCTTCACCGGTGAAAGAGCTTTACAACCCTAGGGCCTTCATCACTCACGCGGCATGGCTGGATCAGGCTTGCGCCCATTGTCCAATATTCCCCACTGCTGCCTCCCGTAA</td>
                            <td> <italic>Brucella abortus</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td> <italic>Brucella melitensis</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td> <italic>Brucella canis</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td rowspan="3">10/4</td>
                            <td rowspan="3">AAGGCAGTTCCGGGGTTGAGCCCCGGGATTTCACCCCTGACTTAAAAGTCCGCCTACGTGCGCTTTACGCCCAGTAAATCCGAACAACGCTAGCCCCCTTCGTATTACCGCGGCTGCTGGCACGAAGTTAGCCGGGGCTTCTTCTCCGGTTACCGTCATTATCTTCACCGGTGAAAGAGCTTTACAACCCTAGGGCCTTCATCACTCACGCGGCATGGCTGGATCAGGCTTGCGCCCATTGTCCAATATTCCCCACTGCTGCCTCCCGTAA</td>
                            <td> <italic>Brucella abortus</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td> <italic>Brucella melitensis</italic> </td>
                            <td>100%</td>
                        </tr>
                        <tr align="center">
                            <td> <italic>Brucella canis</italic> </td>
                            <td>100%</td>
                        </tr>
                    </tbody>
                </table>
            </table-wrap>
            <fig id="F1" position="float">
                <label>Figure 1</label>
                <caption>
                    <p>Electrophoregram of PCR products with primers for 16S rRNA (M &#x2013; molecular weight marker 100 bp.</p>
                </caption>
                <graphic xlink:href="PSJFS-15-1-627_F1.jpg"/>
            </fig>
            <p>The success of brucellosis control depends on the speed of detection of all infected animals and the effectiveness of diagnostic tests (<xref ref-type="bibr" rid="b2">Alton et al., 1988;</xref> <xref ref-type="bibr" rid="b18">Meyer, 1990;</xref> <xref ref-type="bibr" rid="b25">Yagupsky, 1999</xref>). Up-to-date disease detection helps to take steps to isolate the infected animal early as a source of infection (<xref ref-type="bibr" rid="b5">Bricker and Ewalt, 2005;</xref> <xref ref-type="bibr" rid="b20">Ridler et al., 2005</xref>). The following serological tests for animal brucellosis are officially recognized in Kazakhstan: RBS, AR, CBD, and ELISA. The rate of serological reactions in brucellosis is unstable (<xref ref-type="bibr" rid="b9">Ficht, 2010;</xref> <xref ref-type="bibr" rid="b22">Scholz and Vergnaud, 2013</xref>). While each method is complex with other methods, it does not isolate all sick animals. Traditional phenotypic differentiation methods make it difficult to standardize the situation, which is the reason for erroneous differentiation (<xref ref-type="bibr" rid="b19">Pappas et al., 2006;</xref> <xref ref-type="bibr" rid="b14">Godfroid et al., 2011</xref>, <xref ref-type="bibr" rid="b4">Borriello et al., 2013</xref>). It is known that the phenotypic characteristics of bacteria can vary depending on the growing conditions and the allelic state responsible for gene expression. The most conservative structure that characterizes the type of microorganism in its gene (<xref ref-type="bibr" rid="b3">Ayala and Kiger, 1980;</xref> <xref ref-type="bibr" rid="b13">Gershkovich, 1968;</xref> <xref ref-type="bibr" rid="b1">Al Dahouk et al., 2007</xref>, <xref ref-type="bibr" rid="b16">Kattar et al., 2008</xref>). In this regard, the most promising is the assessment based on the nature of the pathogen genome.</p>
            <p>The solution of the problem made it possible to determine the genotype of the studied strains using cluster analysis and to start an investigation of the outbreak in the regions endemic for brucellosis (<xref ref-type="bibr" rid="b10">Frachetti et al., 2017</xref>). Timely provision of information on the causative agent of brucellosis, obtained using multilocus analysis, for the use of scientific research results in veterinary practice, which ensures high-quality monitoring of the epidemic process, effective eradication, and prevention (<xref ref-type="bibr" rid="b17">Le Fl&#xE8;che et al., 2006;</xref> <xref ref-type="bibr" rid="b23">Whatmore, 2009;</xref> <xref ref-type="bibr" rid="b7">Demirev, 2013</xref>). The expediency of the introduction of 16S rRNA is an accurate and timely diagnosis of brucellosis in animals since the timely detection of the disease will help to take measures for the early isolation of the animal as a source of infection and prevent its further development and spread (<xref ref-type="bibr" rid="b12">Garofolo et al., 2013;</xref> <xref ref-type="bibr" rid="b21">Shevtsov et al., 2015</xref>).</p>
        </sec>
        <sec sec-type="conclusion">
            <title>CONCLUSION</title>
            <p>The region of the 16S rRNA gene sequence among the primers used helps to determine 100% affinity, but the specificity is not enough to identify the species. The obtained data are consistent with bacteriological data (colony shape &#x2013; S, bluish-transparent in daylight; microscopy: round negative rods with rounded ends, located immediately; all characteristics correspond to <italic>Brucella abortus</italic>). It can be said that the <italic>Brucella</italic> family is present in the studied samples of microorganisms (no. 4, 5, 7, 8). It turned out that the study of the genetic diversity of brucellosis using <italic>Brucella</italic> spp. The genetic structure of the Kazakh population has not been studied enough.</p>
            <p>Multiple-locus analysis genotyping constitutes a convenient medium-resolution classification assay for large-scale investigations. Follow-up studies based on the whole genome sequencing of selected strains will be necessary to more precisely decipher the dynamics of strain circulation both within Kazakhstan and with Kazakhstan&#x2019;s neighboring countries. Such studies will also permit to design of new low-cost genotyping assays tailored for Central Asia.</p>
        </sec>
    </body>
    <back>
        <sec>
            <title>Conflict of Interest:</title>
            <p>The authors declare no conflict of interest.</p>
        </sec>
        <sec>
            <title>Ethical Statement:</title>
            <p>This article does not contain any studies that would require an ethical statement.</p>
        </sec>
        <ref-list>
            <ref id="b1">
                <label>1</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Al Dahouk</surname>
                            <given-names>S.</given-names>
                        </name>
                        <name>
                            <surname>Le Flèche</surname>
                            <given-names>P.</given-names>
                        </name>
                        <name>
                            <surname>Nöckler</surname>
                            <given-names>K.</given-names>
                        </name>
                        <name>
                            <surname>Jacques</surname>
                            <given-names>I.</given-names>
                        </name>
                        <name>
                            <surname>Grayon</surname>
                            <given-names>M.</given-names>
                        </name>
                        <name>
                            <surname>Scholz</surname>
                            <given-names>H. C.</given-names>
                        </name>
                        <name>
                            <surname>Tomaso</surname>
                            <given-names>H.</given-names>
                        </name>
                        <name>
                            <surname>Vergnaud</surname>
                            <given-names>G.</given-names>
                        </name>
                        <name>
                            <surname>Neubauer</surname>
                            <given-names>H.</given-names>
                        </name>
                    </person-group>
                    <year>2007</year>
                    <article-title> Evaluation of Brucella MLVA typing for human brucellosis.</article-title>
                    <source>
                        <italic>Journal of Microbiological Methods</italic>
                    </source>
                    <volume>69</volume>
                    <issue>1</issue>
                    <fpage>137</fpage>
                    <lpage>145</lpage>
                    <pub-id pub-id-type="doi">10.1016/j.mimet.2006.12.015</pub-id>
                </element-citation>
            </ref>
            <ref id="b2">
                <label>2</label>
                <element-citation publication-type="book">
                    <person-group>
                        <name>
                            <surname>Alton</surname>
                            <given-names>G. G.</given-names>
                        </name>
                        <name>
                            <surname>Jones</surname>
                            <given-names>L. М.</given-names>
                        </name>
                        <name>
                            <surname>Angus</surname>
                            <given-names>R. D.</given-names>
                        </name>
                        <name>
                            <surname>Verger</surname>
                            <given-names>J. M.</given-names>
                        </name>
                    </person-group>
                    <year>1988</year>
                    <source>
                        <italic>Techniques for the brucellosis laboratory</italic>. Paris, France : INRA, 190 p. ISBN 2738000428.</source>
                </element-citation>
            </ref>
            <ref id="b3">
                <label>3</label>
                <element-citation publication-type="book">
                    <person-group>
                        <name>
                            <surname>Ayala</surname>
                            <given-names>F. J.</given-names>
                        </name>
                        <name>
                            <surname>Kiger</surname>
                            <given-names>J. A.</given-names>
                        </name>
                    </person-group>
                    <year>1980</year>
                    <source>
                        <italic>Modern Genetics</italic>. San Mateo, USA : Benjamin/Cummings, 89 p. ISBN 0805303162. </source>
                </element-citation>
            </ref>
            <ref id="b4">
                <label>4</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Borriello</surname>
                            <given-names>G.</given-names>
                        </name>
                        <name>
                            <surname>Peletto</surname>
                            <given-names>S.</given-names>
                        </name>
                        <name>
                            <surname>Lucibelli</surname>
                            <given-names>M. G.</given-names>
                        </name>
                        <name>
                            <surname>Acutis</surname>
                            <given-names>P. L.</given-names>
                        </name>
                        <name>
                            <surname>Ercolini</surname>
                            <given-names>D.</given-names>
                        </name>
                        <name>
                            <surname>Galiero</surname>
                            <given-names>G.</given-names>
                        </name>
                    </person-group>
                    <year>2013</year>
                    <article-title> Link between geographical origin and occurrence of Brucella abortus biovars in cow and water buffalo herds.</article-title>
                    <source>
                        <italic>Applied and Environmental Microbiology</italic>
                    </source>
                    <volume>79</volume>
                    <issue>3</issue>
                    <fpage>1039</fpage>
                    <lpage>1043</lpage>
                    <pub-id pub-id-type="doi">10.1128/AEM.02887-12</pub-id>
                </element-citation>
            </ref>
            <ref id="b5">
                <label>5</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Bricker</surname>
                            <given-names>B. J.</given-names>
                        </name>
                        <name>
                            <surname>Ewalt</surname>
                            <given-names>D. R.</given-names>
                        </name>
                    </person-group>
                    <year>2005</year>
                    <article-title> Evaluation of the HOOF-Print assay for typing Brucella abortus strains isolated from cattle in the United States: results with four performance criteria.</article-title>
                    <source>
                        <italic>BMC Microbiology</italic>
                    </source>
                    <volume>5</volume>
                    <fpage>37</fpage>
                    <pub-id pub-id-type="doi">10.1186/1471-2180-5-37</pub-id>
                </element-citation>
            </ref>
            <ref id="b6">
                <label>6</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Corbel</surname>
                            <given-names>M J.</given-names>
                        </name>
                    </person-group>
                    <year>1997</year>
                    <article-title> Brucellosis: an overview.</article-title>
                    <source>
                        <italic>Emerging Infectious Diseases</italic>
                    </source>
                    <volume>3</volume>
                    <issue>2</issue>
                    <fpage>213</fpage>
                    <lpage>221</lpage>
                    <pub-id pub-id-type="doi">10.3201/2Feid0302.970219</pub-id>
                </element-citation>
            </ref>
            <ref id="b7">
                <label>7</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Demirev</surname>
                            <given-names>P A.</given-names>
                        </name>
                    </person-group>
                    <year>2013</year>
                    <article-title> Dried blood spots: Analysis and applications.</article-title>
                    <source>
                        <italic>Analytical Chemistry</italic>
                    </source>
                    <volume>85</volume>
                    <issue>2</issue>
                    <fpage>779</fpage>
                    <lpage>789</lpage>
                    <pub-id pub-id-type="doi">10.1021/ac303205m</pub-id>
                </element-citation>
            </ref>
            <ref id="b8">
                <label>8</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Ferreira</surname>
                            <given-names>A. C.</given-names>
                        </name>
                        <name>
                            <surname>Chambel</surname>
                            <given-names>L.</given-names>
                        </name>
                        <name>
                            <surname>Tenreiro</surname>
                            <given-names>T.</given-names>
                        </name>
                        <name>
                            <surname>Cardoso</surname>
                            <given-names>R.</given-names>
                        </name>
                        <name>
                            <surname>Flor</surname>
                            <given-names>L.</given-names>
                        </name>
                        <name>
                            <surname>Dias</surname>
                            <given-names>I. T.</given-names>
                        </name>
                        <name>
                            <surname>Pacheco</surname>
                            <given-names>T.</given-names>
                        </name>
                        <name>
                            <surname>Garin-Bastuji</surname>
                            <given-names>B.</given-names>
                        </name>
                        <name>
                            <surname>Le Fléche</surname>
                            <given-names>P.</given-names>
                        </name>
                        <name>
                            <surname>Vergnaud</surname>
                            <given-names>G.</given-names>
                        </name>
                        <name>
                            <surname>Tenreiro</surname>
                            <given-names>R.</given-names>
                        </name>
                        <name>
                            <surname>de Sá</surname>
                            <given-names>M. I. C.</given-names>
                        </name>
                    </person-group>
                    <year>2012</year>
                    <article-title> MLVA16 typing of portuguese human and animal Brucella melitensis and Brucella abortus isolates.</article-title>
                    <source>
                        <italic>PLoS One</italic>
                    </source>
                    <volume>7</volume>
                    <issue>8</issue>
                    <fpage>e42514</fpage>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0042514</pub-id>
                </element-citation>
            </ref>
            <ref id="b9">
                <label>9</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Ficht</surname>
                            <given-names>T.</given-names>
                        </name>
                    </person-group>
                    <year>2010</year>
                    <article-title> Brucella taxonomy and evolution.</article-title>
                    <source>
                        <italic>Future Microbiology</italic>
                    </source>
                    <volume>5</volume>
                    <issue>6</issue>
                    <fpage>859</fpage>
                    <lpage>866</lpage>
                    <pub-id pub-id-type="doi">10.2217/fmb.10.52</pub-id>
                </element-citation>
            </ref>
            <ref id="b10">
                <label>10</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Frachetti</surname>
                            <given-names>M. D.</given-names>
                        </name>
                        <name>
                            <surname>Smith</surname>
                            <given-names>C. E.</given-names>
                        </name>
                        <name>
                            <surname>Traub</surname>
                            <given-names>C. M.</given-names>
                        </name>
                        <name>
                            <surname>Williams</surname>
                            <given-names>T.</given-names>
                        </name>
                    </person-group>
                    <year>2017</year>
                    <article-title> Nomadic ecology shaped the highland geography of Asia’s silk roads.</article-title>
                    <source>
                        <italic>Nature</italic>
                    </source>
                    <volume>543</volume>
                    <fpage>193</fpage>
                    <lpage>198</lpage>
                    <pub-id pub-id-type="doi">10.1038/nature21696</pub-id>
                </element-citation>
            </ref>
            <ref id="b11">
                <label>11</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Gandara</surname>
                            <given-names>B.</given-names>
                        </name>
                        <name>
                            <surname>Merino</surname>
                            <given-names>A. L.</given-names>
                        </name>
                        <name>
                            <surname>Rogel</surname>
                            <given-names>M. A.</given-names>
                        </name>
                        <name>
                            <surname>Martinez-Romero</surname>
                            <given-names>E.</given-names>
                        </name>
                    </person-group>
                    <year>2001</year>
                    <article-title> Limited genetic diversity of Brucella spp.</article-title>
                    <source>
                        <italic>Journal of Clinical Microbiology</italic>
                    </source>
                    <volume>39</volume>
                    <issue>1</issue>
                    <fpage>235</fpage>
                    <lpage>240</lpage>
                    <pub-id pub-id-type="doi">10.1128/2FJCM.39.1.235-240.2001</pub-id>
                </element-citation>
            </ref>
            <ref id="b12">
                <label>12</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Garofolo</surname>
                            <given-names>G.</given-names>
                        </name>
                        <name>
                            <surname>Di Giannatale</surname>
                            <given-names>E.</given-names>
                        </name>
                        <name>
                            <surname>De Massis</surname>
                            <given-names>F.</given-names>
                        </name>
                        <name>
                            <surname>Zilli</surname>
                            <given-names>K.</given-names>
                        </name>
                        <name>
                            <surname>Ancora</surname>
                            <given-names>M.</given-names>
                        </name>
                        <name>
                            <surname>Cammà</surname>
                            <given-names>C.</given-names>
                        </name>
                        <name>
                            <surname>Calistri</surname>
                            <given-names>P.</given-names>
                        </name>
                        <name>
                            <surname>Foster</surname>
                            <given-names>J T.</given-names>
                        </name>
                    </person-group>
                    <year>2013</year>
                    <article-title> Investigating genetic diversity of Brucella abortus and Brucella melitensis in Italy with MLVA-16.</article-title>
                    <source>
                        <italic>Infection, Genetics and Evolution,</italic>
                    </source>
                    <volume>19</volume>
                    <fpage>59</fpage>
                    <lpage>70</lpage>
                    <pub-id pub-id-type="doi">10.1016/j.meegid.2013.06.021</pub-id>
                </element-citation>
            </ref>
            <ref id="b13">
                <label>13</label>
                <element-citation publication-type="book">
                    <person-group>
                        <name>
                            <surname>Gershkovich</surname>
                            <given-names>I.</given-names>
                        </name>
                    </person-group>
                    <year>1968</year>
                    <source>
                        <italic>Genetics</italic>. Moscow, USSR : Nauka, 698 p.</source>
                </element-citation>
            </ref>
            <ref id="b14">
                <label>14</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Godfroid</surname>
                            <given-names>J.</given-names>
                        </name>
                        <name>
                            <surname>Scholz</surname>
                            <given-names>H. C.</given-names>
                        </name>
                        <name>
                            <surname>Barbier</surname>
                            <given-names>T.</given-names>
                        </name>
                        <name>
                            <surname>Nicolas</surname>
                            <given-names>C.</given-names>
                        </name>
                        <name>
                            <surname>Wattiau</surname>
                            <given-names>P.</given-names>
                        </name>
                        <name>
                            <surname>Fretin</surname>
                            <given-names>D.</given-names>
                        </name>
                        <name>
                            <surname>Whatmore</surname>
                            <given-names>A. M.</given-names>
                        </name>
                        <name>
                            <surname>Cloeckaert</surname>
                            <given-names>A.</given-names>
                        </name>
                        <name>
                            <surname>Blasco</surname>
                            <given-names>J. M.</given-names>
                        </name>
                        <name>
                            <surname>Moriyon</surname>
                            <given-names>I.</given-names>
                        </name>
                        <name>
                            <surname>Saegerman</surname>
                            <given-names>C.</given-names>
                        </name>
                        <name>
                            <surname>Muma</surname>
                            <given-names>J. B.</given-names>
                        </name>
                        <name>
                            <surname>Dahouk</surname>
                            <given-names>S. Al.</given-names>
                        </name>
                        <name>
                            <surname>Neubauer</surname>
                            <given-names>H.</given-names>
                        </name>
                        <name>
                            <surname>Letesson</surname>
                            <given-names>J.-J.</given-names>
                        </name>
                    </person-group>
                    <year>2011</year>
                    <article-title> Brucellosis at the animal/ecosystem/human interface at the beginning of the 21<sup>st</sup> century.</article-title>
                    <source>
                        <italic>Preventive Veterinary Medicine</italic>
                    </source>
                    <volume>102</volume>
                    <issue>2</issue>
                    <fpage>118</fpage>
                    <lpage>131</lpage>
                    <pub-id pub-id-type="doi">10.1016/j.prevetmed.2011.04.007</pub-id>
                </element-citation>
            </ref>
            <ref id="b15">
                <label>15</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Gwida</surname>
                            <given-names>M.</given-names>
                        </name>
                        <name>
                            <surname>Neubauer</surname>
                            <given-names>H.</given-names>
                        </name>
                        <name>
                            <surname>Ilhan</surname>
                            <given-names>Z.</given-names>
                        </name>
                        <name>
                            <surname>Schmoock</surname>
                            <given-names>G.</given-names>
                        </name>
                        <name>
                            <surname>Melzer</surname>
                            <given-names>F.</given-names>
                        </name>
                        <name>
                            <surname>Nöckler</surname>
                            <given-names>K.</given-names>
                        </name>
                        <name>
                            <surname>Janczyk</surname>
                            <given-names>P.</given-names>
                        </name>
                        <name>
                            <surname>Tomaso</surname>
                            <given-names>H.</given-names>
                        </name>
                        <name>
                            <surname>Rösler</surname>
                            <given-names>U.</given-names>
                        </name>
                        <name>
                            <surname>Dahouk</surname>
                            <given-names>S Al.</given-names>
                        </name>
                    </person-group>
                    <year>2012</year>
                    <article-title> Cross-border molecular tracing of brucellosis in Europe.</article-title>
                    <source>
                        <italic>Comparative Immunology, Microbiology and Infectious Diseases</italic>
                    </source>
                    <volume>35</volume>
                    <issue>2</issue>
                    <fpage>181</fpage>
                    <lpage>185</lpage>
                    <pub-id pub-id-type="doi">10.1016/j.cimid.2011.12.012</pub-id>
                </element-citation>
            </ref>
            <ref id="b16">
                <label>16</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Kattar</surname>
                            <given-names>M. M.</given-names>
                        </name>
                        <name>
                            <surname>Jaafar</surname>
                            <given-names>R. F.</given-names>
                        </name>
                        <name>
                            <surname>Araj</surname>
                            <given-names>G. F.</given-names>
                        </name>
                        <name>
                            <surname>Le Flèche</surname>
                            <given-names>P.</given-names>
                        </name>
                        <name>
                            <surname>Matar</surname>
                            <given-names>G. M.</given-names>
                        </name>
                        <name>
                            <surname>Rached</surname>
                            <given-names>R. A.</given-names>
                        </name>
                        <name>
                            <surname>Khalife</surname>
                            <given-names>S.</given-names>
                        </name>
                        <name>
                            <surname>Vergnaud</surname>
                            <given-names>G.</given-names>
                        </name>
                    </person-group>
                    <year>2008</year>
                    <article-title> Evaluation of a multilocus variable-number tandem-repeat analysis scheme for typing human brucella isolates in a region of brucellosis endemicity.</article-title>
                    <source>
                        <italic>Journal of Clinical Microbiology</italic>
                    </source>
                    <volume>46</volume>
                    <issue>12</issue>
                    <fpage>3935</fpage>
                    <lpage>3940</lpage>
                    <pub-id pub-id-type="doi">10.1128/JCM.00464-08</pub-id>
                </element-citation>
            </ref>
            <ref id="b17">
                <label>17</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Le Flèche</surname>
                            <given-names>P.</given-names>
                        </name>
                        <name>
                            <surname>Jacques</surname>
                            <given-names>I.</given-names>
                        </name>
                        <name>
                            <surname>Grayon</surname>
                            <given-names>M.</given-names>
                        </name>
                        <name>
                            <surname>Al Dahouk</surname>
                            <given-names>S.</given-names>
                        </name>
                        <name>
                            <surname>Bouchon</surname>
                            <given-names>P.</given-names>
                        </name>
                        <name>
                            <surname>Denoeud</surname>
                            <given-names>F.</given-names>
                        </name>
                        <name>
                            <surname>Nöckler</surname>
                            <given-names>K.</given-names>
                        </name>
                        <name>
                            <surname>Neubauer</surname>
                            <given-names>H.</given-names>
                        </name>
                        <name>
                            <surname>Guilloteau</surname>
                            <given-names>L. A.</given-names>
                        </name>
                        <name>
                            <surname>Vergnaud</surname>
                            <given-names>G.</given-names>
                        </name>
                    </person-group>
                    <year>2006</year>
                    <article-title> Evaluation and selection of tandem repeat loci for a Brucella MLVA typing assay.</article-title>
                    <source>
                        <italic>BMC Microbiology</italic>
                    </source>
                    <volume>6</volume>
                    <issue>1</issue>
                    <fpage>9</fpage>
                    <pub-id pub-id-type="doi">10.1186/1471-2180-6-9</pub-id>
                </element-citation>
            </ref>
            <ref id="b18">
                <label>18</label>
                <element-citation publication-type="book">
                    <person-group>
                        <name>
                            <surname>Meyer</surname>
                            <given-names>M. E.</given-names>
                        </name>
                    </person-group>
                    <year>1990</year>
                    <source>Evolutionary development and taxonomy of the genus Brucella. In Adams, L. G. <italic>Advances in Brucellosis Research</italic>. Galveston, USA : Texas A&#x26;M University Press, 542 p. ISBN-13 978-0-89096-447-7.</source>
                </element-citation>
            </ref>
            <ref id="b19">
                <label>19</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Pappas</surname>
                            <given-names>G.</given-names>
                        </name>
                        <name>
                            <surname>Panagopoulou</surname>
                            <given-names>P.</given-names>
                        </name>
                        <name>
                            <surname>Christou</surname>
                            <given-names>L.</given-names>
                        </name>
                        <name>
                            <surname>Akritidis</surname>
                            <given-names>N.</given-names>
                        </name>
                    </person-group>
                    <year>2006</year>
                    <article-title> Brucella as a biological weapon.</article-title>
                    <source>
                        <italic>Cellular and Molecular Life Sciences</italic>
                    </source>
                    <volume>63</volume>
                    <fpage>2229</fpage>
                    <lpage>2236</lpage>
                    <pub-id pub-id-type="doi">10.1007/s00018-006-6311-6314</pub-id>
                </element-citation>
            </ref>
            <ref id="b20">
                <label>20</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Ridler</surname>
                            <given-names>A. L.</given-names>
                        </name>
                        <name>
                            <surname>Leyland</surname>
                            <given-names>M. J.</given-names>
                        </name>
                        <name>
                            <surname>Fenwick</surname>
                            <given-names>S. G.</given-names>
                        </name>
                        <name>
                            <surname>West</surname>
                            <given-names>D. M.</given-names>
                        </name>
                    </person-group>
                    <year>2005</year>
                    <article-title> Demonstration of polymorphism among Brucella ovis field isolates by pulsed-field gel electrophoresis.</article-title>
                    <source>
                        <italic>Veterinary Microbiology</italic>
                    </source>
                    <volume>108</volume>
                    <issue>1-2</issue>
                    <fpage>39</fpage>
                    <lpage>74</lpage>
                    <pub-id pub-id-type="doi">10.1016/j.vetmic.2005.02.004</pub-id>
                </element-citation>
            </ref>
            <ref id="b21">
                <label>21</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Shevtsov</surname>
                            <given-names>A.</given-names>
                        </name>
                        <name>
                            <surname>Ramanculov</surname>
                            <given-names>E.</given-names>
                        </name>
                        <name>
                            <surname>Shevtsova</surname>
                            <given-names>E.</given-names>
                        </name>
                        <name>
                            <surname>Kairzhanova</surname>
                            <given-names>A.</given-names>
                        </name>
                        <name>
                            <surname>Tarlykov</surname>
                            <given-names>P.</given-names>
                        </name>
                        <name>
                            <surname>Filipenko</surname>
                            <given-names>M.</given-names>
                        </name>
                        <name>
                            <surname>Dymova</surname>
                            <given-names>M.</given-names>
                        </name>
                        <name>
                            <surname>Abisheva</surname>
                            <given-names>G.</given-names>
                        </name>
                        <name>
                            <surname>Jailbekova</surname>
                            <given-names>A.</given-names>
                        </name>
                        <name>
                            <surname>Kamalova</surname>
                            <given-names>D.</given-names>
                        </name>
                        <name>
                            <surname>Chsherbakov</surname>
                            <given-names>A.</given-names>
                        </name>
                        <name>
                            <surname>Tulegenov</surname>
                            <given-names>S.</given-names>
                        </name>
                        <name>
                            <surname>Akhmetova</surname>
                            <given-names>A.</given-names>
                        </name>
                        <name>
                            <surname>Sytnik</surname>
                            <given-names>I.</given-names>
                        </name>
                        <name>
                            <surname>Karibaev</surname>
                            <given-names>T.</given-names>
                        </name>
                        <name>
                            <surname>Mukanov</surname>
                            <given-names>K.</given-names>
                        </name>
                    </person-group>
                    <year>2015</year>
                    <article-title> Genetic diversity of Brucella abortus and Brucella melitensis in Kazakhstan using MLVA-16.</article-title>
                    <source>
                        <italic>Infection, Genetics and Evolution,</italic>
                    </source>
                    <volume>34</volume>
                    <fpage>173</fpage>
                    <lpage>180</lpage>
                    <pub-id pub-id-type="doi">10.1016/j.meegid.2015.07.008</pub-id>
                </element-citation>
            </ref>
            <ref id="b22">
                <label>22</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Scholz</surname>
                            <given-names>H. C.</given-names>
                        </name>
                        <name>
                            <surname>Vergnaud</surname>
                            <given-names>G.</given-names>
                        </name>
                    </person-group>
                    <year>2013</year>
                    <article-title> Molecular characterisation of Brucella species.</article-title>
                    <source>
                        <italic>Revue Scientifique et Technique</italic>
                    </source>
                    <volume>32</volume>
                    <issue>1</issue>
                    <fpage>149</fpage>
                    <lpage>162</lpage>
                    <pub-id pub-id-type="doi">10.20506/rst.32.1.2189</pub-id>
                </element-citation>
            </ref>
            <ref id="b23">
                <label>23</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Whatmore</surname>
                            <given-names>A. M.</given-names>
                        </name>
                    </person-group>
                    <year>2009</year>
                    <article-title> Current understanding of the genetic diversity of Brucella, an expanding genus of zoonotic pathogens.</article-title>
                    <source>
                        <italic>Infection Genetics and Evolution</italic>
                    </source>
                    <volume>9</volume>
                    <issue>6</issue>
                    <fpage>1168</fpage>
                    <lpage>1184</lpage>
                    <pub-id pub-id-type="doi">10.1016/j.meegid.2009.07.001</pub-id>
                </element-citation>
            </ref>
            <ref id="b24">
                <label>24</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Whatmore</surname>
                            <given-names>A. M.</given-names>
                        </name>
                        <name>
                            <surname>Shankster</surname>
                            <given-names>S. J.</given-names>
                        </name>
                        <name>
                            <surname>Perrett</surname>
                            <given-names>L. L.</given-names>
                        </name>
                        <name>
                            <surname>Murphy</surname>
                            <given-names>T. J.</given-names>
                        </name>
                        <name>
                            <surname>Brew</surname>
                            <given-names>S. D.</given-names>
                        </name>
                        <name>
                            <surname>Thirlwall</surname>
                            <given-names>R. E.</given-names>
                        </name>
                        <name>
                            <surname>Cutler</surname>
                            <given-names>S. J.</given-names>
                        </name>
                        <name>
                            <surname>MacMillan</surname>
                            <given-names>A. P.</given-names>
                        </name>
                    </person-group>
                    <year>2006</year>
                    <article-title> Identification and characterization of variable-number tandem-repeat markers for typing of Brucella spp.</article-title>
                    <source>
                        <italic>Journal of Clinical Microbiology</italic>
                    </source>
                    <volume>44</volume>
                    <issue>6</issue>
                    <fpage>1982</fpage>
                    <lpage>1993</lpage>
                    <pub-id pub-id-type="doi">10.1128/jcm.02039-05</pub-id>
                </element-citation>
            </ref>
            <ref id="b25">
                <label>25</label>
                <element-citation publication-type="journal">
                    <person-group>
                        <name>
                            <surname>Yagupsky</surname>
                            <given-names>P.</given-names>
                        </name>
                    </person-group>
                    <year>1999</year>
                    <article-title> Detection of Brucellae in blood cultures.</article-title>
                    <source>
                        <italic>Journal of Clinical Microbiology</italic>
                    </source>
                    <volume>37</volume>
                    <fpage>3437</fpage>
                    <lpage>3442</lpage>
                    <pub-id pub-id-type="doi">10.1128/jcm.37.11.3437-3442.1999</pub-id>
                </element-citation>
            </ref>
        </ref-list>
    </back>
</article>